Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677839
Length 804 bp
Fasta Format > whok10f21
atgtgcattgattgatgaaaggcataagaaggaatttggtaaagaaatgc tgattctctcccagatcaatcacaagaacatcgtcaagctgttgggctgc tgcctggaggtggaagtcccaatgctggtgtatgagttcatcccaaaagg aacattgtttgatcttcttcacggaaagaaccgcacacggcacatcccat tcagttcgctcttaaggatcgtaaatgaggcagcagaggggcttgcattt ttacattcctatgcaaacccaccaattctacatggtgatgtgaaaacttc taacatccttcttgatgacaattacatggcaaaggtatccgactttgggg cttccatactagtaccaactgatcaagcccagtttgtgacaatggttcaa gggacttgtggttatctggatcctgaatatatgcagacatgtcggttgac agataaaagcgatgtttatagctttggtgtcgtccttttggaagtcctta ctgggcaggtgccactaaaactggaaggtaatgagtcacaaagaagcttg gcatcatgtttcctagtggctatgaaggagaacaaccttgatgccatgtt ggatagtcaaataaaagatcacgagagcatggagctgcttactggactag cggaactagcaaagcaatgcttggatatgtgtggtgacaacaggccctcc atgaaagaggtatctatggagcttaccagattaaggaggctttccaaaca tccttggatgcatcacgatgctgatacagagagctttctcagtgcaccat caac
Download
page-top