Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677834
Length 754 bp
Fasta Format > whok10f06
agatcgaggagatccccgaggacaacaccgccggatgcgacgccatccgc aaggcttttgccatggggaacggcaaggggaaggccaaggagctgtcgcc gcaggacgccgcgctgctcatccagatgaactacagggcgcacctcgccc accgctcccaggtgctccgctgcctgcgcgatctcgccgtggccaaggcc aagctcaaggagctcaggtccctcttctacaacctctcctacaggcgccg cctctcgcatgaccacgaggagcgccagaggttctccgagaagatcattg tcctgctcctcactgtcgacgcgctcgagggacctgacttcatggtgagg acggcgaagaaatctatgctggaggaactggagagcatgctggagatcgt ggacccgcagccaccagggaagcagaggtcgttcaaccgccgcaagttcg atcttccagagggcggagcgatcccaaatgagaaaaccgctggcgtgaac aacgctgtcagagtcatcaacactggcaagggcaagcagtaggcactagc gcctcgtttagtgcccggtaccatggccgatcgatggagcttgtagcgcc gctttgtctgtgagatagtccggttcgtcttagatttctagtacctttga gatttgagaagggttgaacttgtcgtgcaccattatccgggatgtcgtag cgtgtatgaaccgtattgtttgtttggacttgttgtaatgtatgctgttg ttga
Download
page-top