Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677833
Length 789 bp
Fasta Format > whok10f05
gtcatctgaatctgctcccgtcctctcctcttctcttccccccgaagcag cagcgtccctcctctccgcccggatcgcgatggccgccgccgccgtcgcc gccgactccaagatcgacaacctccgcgacgccgtcgccaagctcggcga gatcagcgagaacgagaaggccggcttcatcagcctcgtctcgcgctacc tcagcggcgaggcggagcagatcgagtggagcaagatccagacccccacc gatgaggtggtggtgccctacgacaccctcgcgccccctcccgaagatct cgacgccatgaaggctctgctcgacaagctcgtggtgctcaagctcaacg gaggcctcggcaccaccatgggctgcaccggccccaagtccgtcattgaa gttcgcaatgggtttacatttcttgaccttattgtgattcanattgagtc cctgaacaagaagtatggatgcagtgttcctttgcttctaatgaactctt tcaacactcatgacgacacacagaagattgttgagaagtactccaactcc aacattgaaattcacactttcaaccagagccaataccctcgcattgttac tgaagacttcttgccacttccaagcaaagggcanacagggaaggatggct ggtaccccccaggccacggtgatgtgttcccctctttgaacaacagtgga aaactcnataccttactgtcacagggaaaggagtatgtcttcntggcgaa ctcanacaacttgggtgctatanttgacatcaanatact
Download
page-top