Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677830
Length 676 bp
Fasta Format > whok10e22
tcgcagcacaccagcttagacatggccgccgccacctccaccgtctccgg cctcgccggcgccgcgctcacccgccggccagccttctctaccagcttca cgagtggtgcccgggtgtcggcgaggaacccgctgatgacgaggaacctg gagaggaacggcaggatcacctgcatgacgttcccgcgggactggctgcg gagggacctgaacgtgatcgggttcgggctgattgggtggctggcaccgt cgagcatcccgctgatcaacggcaacagcttgacggggctcttcttctcc agcatcggcgaggagctcgcccacttcccgtcgcccccggctctccagtc gcagttctggctgtggttggtgacgtggcacctgggtctgttcatcgcgc tcaccttcggccagatcgggttcaagggcaggaccgaggactacttccag aagtagcgaattaactagctttggttcgtgcatgtgcgtcgtccttgggc tgctcaagggctgcttctgcgcatgcgtgttcaatgtaaaatctgccatg ccttttggttttgtgcatgcgtgtggcttcncaagccgtgtgattgctgt ttgttaattacctcttccatggtaagcacaaaanagttcaacaacgacaa ctactactacaacaacaaaaaaaaaa
Download
page-top