Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677823
Length 709 bp
Fasta Format > whok10e10
cgcggcgaagccctagcctccggccagcgccgccgccgcagcgatggtgt acttcgactcatgggacgagttcgtcgaccggtccgtgcagctcttccgc gccgaccccatcaccactcgctattgtatgaagtaccggcactgcgacgg gaagctcgtgctcaaggtcaccgacgaccgcgagtgcttgaagttcaaga cggatcaagctcaggacgcaaagaagatggagaagctcaacaacatcttt ttcgctctcatgactcgtggacctgatgctgacataagcgaggtttcagg gaaggaacaagcggagcagcagcaatcaaagaagggacggggcaggaggc agtagtatcatgctctggatttctttcagaaagatcacaactgggagtgg tgggtggatattttgatcgactcctgttaagccatgttacaactgtgagt ggtgggtggtctaagagtggcgagtagttttcaagacaatgtgcgagcca tcgttggatccttttcctggcacagaaccgcgaattacacttacccacac aatcatggttgatgagacaaatcaaatctttgaccgtctgcgtgttttgt tgatgaatcatggttgacaagacaatcaaatcattccccgcctgcgtgct ttggtgatgatttttcgttcaggaatatggcaaaatgttttcttgaatca aaaaaaaaa
Download
page-top