Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677820
Length 714 bp
Fasta Format > whok10e05
ctcgccggagagggaggagagatggccaggaagggcggagagaggaanaa ggcggtgacccggtccaccaaggccggcctccagttccccgtcggccgca tcgggcgcttcctcaagaagggccgctacgcgcagcgcgtcggctccggc gcccccgtctacctcgccgccgtcctcgagtacctcgccgccgaggtgct ggagctcgccggcaacgccgccaaggacaacaagaagacccgcatcgtgc cgcgccacctgctcctcgccatccgcaacgaccaggagctcggcaagctg ctcgccggcgtcaccatcgcgcacggcggcgtgatccccaacatcaaccc cgtgctgctccccaagaaggccctcgagaaggccgagaaggagtcccagt cgcccaantcgcccaagaggaaggcccccncccncgcacccnccgccaag aagacccccaagaanaccgccgccgacaagaagancgccgccgccganna gaanaccgccgccgccgacaagaagaccgccgccgctgacaataagacng ncgccgccnacaanaaggctgccgccgacgccgaggaggaggccgccgcc gacgagtagacagggcaaagttgcgtcgcgtagttctgcatctgagaggg gagagaaagagatagagcatgggatcctgtatgtaatgcctggtctggag tccgaactggtggt
Download
page-top