Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677815
Length 831 bp
Fasta Format > whok10d21
agccgcaagcgagcagagcacaccgcacacgtagcagtttccctttcaga tattttcttcgactagccaccatgactgctttggccaagccctccgcctc agcgccgaagccgaagaagacctccgccgctggagccgcccacccgacct acttcgagatgatcaaggaggcgatcgcggctctcaaggacaggaccggg tcgagctcggtcgccatcgccaagttcatcgaggagaagcacggcaaggc cctcccggccaacttcaagaagatgctctccgtccagctccgctcctccg ccgccaagggcaagctcgtcaaggtcaaggcctcctacaagctctccgac gccgccaagaaggactcccccaagcccaaggccaagcccgccgcccccaa ggctgcggcgaagcccgcaaaggacgccgccaagcccaagaagaaggcct ccgcgaagcccaagaaggccgccgccgctggcacgaagcgcaaggcaccc gagaagaagaagctggtcgccaaagccaagaagtcgcccgcggcgaaggc caaggcgaagccgaagaccgtccgctccccggccgccaagaaggcccgca aggtcgcctccgcttgatctgatctgatctgatcttataggtggttttag gtgtgcgttggtgctctgggtctgtacaaaaggatgcctcatcctccctg atttaggcttcggttctgctaggcaggttctatgtactatcgctggtggt gtttantgtctggaatgttcaggtgtcanatgtatccagctcaaactctg aaatgaaatttgcagtttcccaaaaaaaaaa
Download
page-top