Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295194
Length 736 bp
Fasta Format > rwhsl2c23
ccgttgttatttatttatttattgtgttgtacacaacgttgtttacatag catcaagaagagcctgctgcatcatctccactccactccttcagcctcca ttgttgtgagtcgtcgtagatggcgactggtgacttaggtgggagctcag ttctcgtgatcccagacttcagatgcactcttgtacggcccatgggtctt gttcacgaacagctcctctccggtcagcacacgcttctcatctttgatgc tgcacaggaccttgaagtcctcctcagggatctcccacccgaacacctgg atgttctccttgatcctctcgtctttgcttgacttgggaatcacactcgt ccccctctgcagagcccacctgatgagcacctgccccggggtcttgttca gcttgttggccaccttttcgacaaccgggtcatgagcaaggttcttctct gaagaacccaatggtgagtaagcggtgacatggatcccgcgcttcttgca ggcctcgaacatcttgtcgttcttccaaccagggtgcatctccatctggc aaacggccggtggaatctttgcagaccgtagcagccggtcgagcttggtc acggtgtagttgcagacgccgatgtccttaaccagtccgtccttgacaag gttctccatctccttccacaccccctccatgtcgaattccagcacctccc ctgcttccggaggcttgtgtgccccatctttcagcc
Download
page-top