Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677812
Length 708 bp
Fasta Format > whok10d16
ggggtgccccgccatccgctgcaccgccgacggcgtctacttcgcggagg ccgtggcggagtgcagcctggaggacgtgcggttcctggagcgccccctg ctgctccccaaggaggacctcgtcccctaccccgccgacgatctctgggg cgtcgaaccccacaacaccatcatgatgatgcagatcacgaagttcacct gcggcgggttcgtgatgggcctgcggttcaaccacgcgtcggcggacggc atgggcgcggcgcagttcatcaaggccgtgggcgacatggcgcgggggct cccggagccggcggtgaagccggtgtgggacagggagaagttccccaacc cgagcatcaagccggggccgctcccggagctccccgtgctggcgctggac tacatcgtgctcgacttccccacgggctacatcgacgcgctcaaaacgca ntacaaggcgcacagcggcaagttctgctccggcttcnacntgctgacgg ccaanctgtggcantgccncacccgggcnctgaacctgnancccnangcn acngtgaanctctgcttcttcnccancntgcnccacctgctgaanctgga cncnnngtactacngcaactccatcttccccntnaanatntccnnnanca ncaanaangtgctgnantcntcnntnatnnangtnatcnanatnatccnn nannnnaa
Download
page-top