Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677809
Length 705 bp
Fasta Format > whok10d13
tacagttgctggttgcatctgttgtaagaggcatccggttccttcagaca ctaactggagtgtggctctgatctcattcatcgtatcttgggtcactttc ataatcgcgttccttctcctgctgaccggagccgcgctgaacgaccaaag gggccaggagaacatgtacttcggcagcttctgctacgtcgtcaagccgg gggtcttctccggaggggcggtgctctccctcgcgagcgtggccctggcc atagtctactacgtggccctgacgtcgtcgaaaggcccgccgagctgggg cccgcagcagaaccagggcatctccatgggccagcccgtgatcccgcagc agagcagcgagccggtgttcgtccatgaggacacctacaaccggcaacag ttcccatgagtgatcacagccatattcaagccagccatttcgagggtcgc ccatgaggacacttgcaaccggcagcagttcccgtgatcgcagtcgtagt acctaagccgtttcgacggcccacatgaacgctatgttggcgagtttggt ttgtatagccctgcaggttagaacaatagcagcagcttggttaccgttat tattanctaggttcatcagtcttctctttttctttgtttgagacttgaga aaggcggcggcatgcctgtttcgtcggtatggatatttgaattttaaaaa aaaaa
Download
page-top