Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677806
Length 805 bp
Fasta Format > whok10d10
ccgccgccgcctcctctcggttccttctccttcctcggagccatgggtaa ggagaagactcacatcaacatcgtggtcattggccatgtcgactctggca agtcgacaaccactggccatctgatctacaagcttggaggtattgacaag cgtgtgatcgagaggtttgagaaggaagccgctgagatgaacaagaggtc tttcaagtacgcctgggtgcttgacaagctgaaggccgagcgtgagaggg gtatcaccattgatattgccctgtggaagttcgagaccaccaagtactac tgcaccgtcattgatgcccctggtcaccgtgacttcatcaagaacatgat tactggtacctcccaggctgactgtgctgtgctcatcattgactccacca ctggtggttttgaggctggtatctccaaggatggccagacccgtgagcac gccctccttgctttcacccttggagtgaagcagatgatctgctgctgcaa caagatggacgccaccactcccaagtactcaaaggcccgttatgaggaaa ttgtcaaggaagtctcttcgtacctgaagaaggtcggctacaaccctgac aaggttcccttcgttcccatctctgggtttgagggtgacaacatgattga gaggtccaccaaccttgactggtacaagggccctacccttcttgaggctc ttgaccagatcaatgagcccaagaggccctcagacaagcccctgcgtctt ccccttcaggatgtttacaagattggtggcattggaactgtgcctgttgg ccgtg
Download
page-top