Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677805
Length 814 bp
Fasta Format > whok10d08
ctctccctccctccctctcggccgatttactccctcctcggctgccctgc cctcccctgtttgaggcaatggcggcggcggcggtgaacggcgggggcgg ggagaacaaggcggcgttcgcgcggatctacgacgcgctcaaggcggagc tgctcagggaccccgccttcgagtacacggagtcgtcgcgccagtggatc gaccgcatgctggactacaatgtactgggaggaaagtgcaaccgtgggct ctctgtggtcgacagctataagctgttgaaaggcgtcgatgttcttactg aggaggagatgtttcttgcctccactctcggttggtgcattgaatggctt caagccttctttcttgtgctcgatgatatcatggacgactcccacactcg acgtgggcagccttgttggtttagggtgtctcaggttggcttgattgctg taaatgatgggattctccttcgcaaccatatttcgagaatgcttcggctc cactttaagaagaagccttactatgccgatctccttgatttattcaacga ggttgagttcaagacagcttctggtcaaatgctggaccttattacaaccc acgagggagaaaaagatctaacgaaatataacattggagtccaccgccga attgttcaattcaagacagcctactattcattttatctgccggttgcatg tgcgctgctactctccggcgagagtttggagaactacagtgctgtanana acatacttgttgagatggggaacttacttccaagttcangatgattatct anactgttatggtg
Download
page-top