Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677802
Length 819 bp
Fasta Format > whok10d03
cgccgagccgggaagagccaccaccccatcttcctcgcctccgcttccga agggtcagagatggcggaccgtgctaaccacccgtctgtcatgcagaagt ttggtggacagttccaccttgcctccagcttctctgagggtgttcgtgct cgcaacatctgcccttctgtgccatcctatgagaggcgcttcaccacaag ctgctacatgactcagaaccttggcatcagtgtccccatgatgtcatctt ctccattgtttgccaatgcaccacctgagaagaaaggtgtcaagaacttt gcaattgacttcctcatgggaggagtgtccgctgcagtttccaagactgc tgcagctcctattgagcgtgttaagctgcttatccagaaccaggatgaga tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgc tttggccgcaccatcaaggatgaaggctttggctcattgtggagaggaaa cactgctaacgtcatccgttacttcccaactcaggctttgaactttgcat tcaaggattacttcaagaggatgttcaacttcaagaaggacaaggatggt tactggaagtggttcggtggcaaccttgcttctggtggtgctgctggtgc ttcctcgctcttcttcgtgtactccctggactatgctaggacaaggctgg ccaatgacgcaaaggcatccaagggtggaggtgacaggcaattcaatggc ctggttgatgtctaccgcaagactctcaantcanatggtattgctgggct ttaccgtggattcaacatc
Download
page-top