Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677801
Length 594 bp
Fasta Format > whok10d01
gcatcaacacgaactcgctctctttctctggtgcaaggaggggcaatgca tttcttcgtctgcagccagtgccgatgagatttgctgtttgctgctcagc aaagcaggatacagtggagaaggtttgtgaaattgttaagaagcagcttg ctgttcctgaaggcactgaagtttgcggtaccaccaagttctctgacctt ggagctgattcactggacacggtcgagattgtgatgggcctcgaggagga gttccagatcagcgtggaggagacgagtgcgcaggcaattgcgacagttg aagatgctgccacgctcatcgacaagcttgtctctgcgaagtcatcttga agggaggtcgtaaatcgtaatgattggagctcgtaagctagtagtcctac cttgggttgatccttgttgttctaccatagtcgttattatatggtgggtt ggtgattttctcaggactatcgtctcctgctgtgtgtaataagataattg gttaagtatgtaagctgttgaacatcnaagtgcctanttttcntgcggct gtggtgcatgtanatgtatgcatcttttgtgcccaaaaaaaaaa
Download
page-top