Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677800
Length 803 bp
Fasta Format > whok10c23
ctgtgccaagggagatgaccaagctctctggaatctctgacattatccct gagatggaggtctgtgacttcgacttcgagccctgcggctactccatgaa cgccatcaacggatctgccgtctccaccatccatgtgacccccgaggacg gcttcagctacgcgagctacgaggtcatgggcatggacgcctccgccctg gcctacggcgacatcgtcaagagggtcctccggtgctttggcccttcaga gttctctgtggcggtcaccatcttcggtggccgtggccacgccgccacct ggggcaagaagctcgaagctgaggcatacgactgcaacaacgttgtggag caggagctcccctgcgggggcgtcctcatctaccagagctttgccgcgaa cgaagaggttgctgtctctgccgggtcgcccaggtccgtcttccactgct tcgaggccgagagtgtgcagagccaccctctggtcaaggaaggcaagctc gccaacctcctcgcatggcgggcggaggaggattccctggaggagggcgc ggtgctgtgcgagtgattggctgtcgctgttccgtctgtggactttgttc tgactaagtttgtcgtttggttactgtgaancanctggccangctattgc tactccnaataaactattanctctangtggtttgctgcntctgccacaat gancgtacttctgggganaanttgtctcaaactgataaataancattttt tttctaanaacnantgtcactttgttatcatattcatgttctgnaatnna aac
Download
page-top