Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677796
Length 715 bp
Fasta Format > whok10c19
atgccccgtctcactggatgcttgacaagcttggtggagcttttgccccc aagccatcatctggtcctcacaaggccagggagtgcctgcctctgatcct catcctgaggaacagactgaaatatgctctcacctaccgtgaagtgcaat ctatccttatgcagcgtcatatcatggttgatggaaaggtccgcactgac aagacctaccctgctgggttcatggacatcatttccattcccaagactgg tgagaactacaggcttctttatgacaccaagggtcgcttccgccttcact ctgtcagggatgaggatgctaagttcaagctctgcaaggtcaggtctgtc cagttcggccagaagggcatcccctacctgaacacctatgatggccgcac catccgctacccagacccactcatcaaggccaatgacaccatcaagctcg acctggagaccaacaagattgttgacttcatcaagtttgacgtcggcaat gtggtcatggttactggtgggcgcaacactgggcgtgttggtgtgatcaa gaacagggagaagcataagggaaccttcgagaccatccacgttgaggatg cgcagggccaccagtttgccacccgtctgggcaacgtgttcaccatcggc aagggcaccaagccgtgggtgagcctccccaagggcaagggtatcaagct caccatcattgagga
Download
page-top