Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677795
Length 713 bp
Fasta Format > whok10c18
cccctcccacgccgtctcgtcccagctcgccctccagaggttttagtctt cctccatggcggccctcatcaagctcggaagccttcttaggcagagtgct ttggcgagcagtgcctcgaccggctcggctcctgccctgttcaacgctgc ccgcttcatgtgcgccggccagcccgctggtggcaataagcttttcgtcg gcggcctggcctgggctactgacgatcattcgctgaaggaggcgttccaa agctttggagaggtcgttgaggcacgtgtcatcactgatcgagagactgg aaggtctagagggtttggttttgtgagctttgcgaatgaagctgatgcag atagcgctgcaaaaggcatggacggtcaggagcttgcagggaggaacgtc cgtgtgaacttcgccaatgagaggccttcgggtggtggcggcttctcacg cggcggcggtggctatggaggaggtggtggctttggcggcggcggcggct atggtggtggcggcggcggctatggcggtggtggccnaggtggcngtggc tatggtggtgaccntgaanctttctaanganancncanactatcaaattt aaaataatgcncttttangacantgtcttgattatgtnnaacctatntca cntctgtctgttatctgnnatanntnaactcaatangancananatgnnn nntctannatttt
Download
page-top