Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677793
Length 861 bp
Fasta Format > whok10c14
atgagaagaaccttccattaccaaatggcgctgggaattcaggcagtcac agcacgtcagcttttggtttggaacgtcagggcagcagcattactgtgcc cctgccgttgagcaagaagacagtggatgaaatttggagaaacatccagc aggaagaggagagtagtgatgacgagaaaaggagttcaggttgtgaggca cagatgtcgtttggggagataacacttgaggagttcttgcaaagggctgg cattgttaccgggcagtatcagaaggatgctgaggagttaattgatcttg taggaactggagaaagtgctcatttgatgaccagagtgcaggatttccca cagggaacaagtgcaattgatgcgtatattgtacgtcagtcaattgcgca accgctgagtgttgcaatcccttcgacaatggattccatctacccagatc gtcaaatgagtatttcgtcatctctagaactttctgatcttcaaagtcct agtcataagagaatgtcttcccaggatgtggtatacaaggttgctgatcg gaggcagaagaggatgatcaagaaccgagaatcggctgcacgttcaagag ctaggaaacaggcctacacaaacgagctcgaatgcaaattgtcttgtctg gaagaggagaacaagaggctgaagagagagaaggagttggacatgttatt gaagtccgcgccccctccanaaccgaaaaaacatcatcggagaacgagat cgacctcattctaattgtgtgtanagtacaggcctctggtanattttgat cacccttttgctttctcctcccatgtaactatggagcgtgtgcantttgc tttgcttgtaa
Download
page-top