Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677792
Length 703 bp
Fasta Format > whok10c12
cacgcctgcctcatctctcggagcaggaggaggaggagcttgcaggaaca atggcggcccagggtcttctctctgggaggcagctgctggggaggcctct gcagtcttccatctccaggtcgtcttcctcccggaagtcccccttcgtcg tcagggcatcttccagcccccctgccaagcaaaatgacaacaggcagctg tggtttgcgtccaagcagtccctcacctacctcgacggcacgctgcccgg tgactttggcttcgaccccttggggctgtccgacccagagggcaccggcg ggttcatcgagcccaggtggctggcctacggcgagatcttcaacggccgg acggcgatgatgggggtggtgggcatgatcgccccggaggccctgggcaa ggtgggtctggtgcccccggagacggcgatcccgtggttccangcaggcg cgatcccgccggcaggcacctaccantactgggccgacccctacacgctc ttcntgttcnanatggcnctcatcngcttcncggancaccgncggctcca ngactggtacaacccngnctccatggncaancantacttcctgggcctcn anaantacctcngtggctccngcnaccccncctaccccnncnnncccatc ttcaanccnctcngnttcnnnaccaanaancnanaannanatnaannanc tca
Download
page-top