Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677785
Length 338 bp
Fasta Format > whok10c05
ttcatctgttcctctctgctctgctttctgactcnaaactgcaacaatgg ctgccccgacctctgcgatcggatttgagggctacgagaagcgccttgag atcaccttctctgaggcatcaatctttgctgaccctcatggtcgtggcct gcgcgccctctccagggcccanattgactctgttcttgatcttgcacggt gcaccattgtgtccnanctctccaacaangactttgactcntacntgcta tccnantcnancttgtttatctactctcanaanattgtgatcaanaccct gtgggactaccatgctcctgctcaccattccaangatt
Download
page-top