Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677783
Length 769 bp
Fasta Format > whok10c02
agcacactcttggtgctctccgctccctggtcgttcggtcgttggaagtt ggaacctcctcctcctcctccgcagccgcgggcggcgtcgggaggtttcc gggctgcgcgttggtgcatgcaacagaggggcctctccaacaaccgccgc tcccgcggcttctcccgatcccgcctcgccgtcgagggcgcctaaacaga accccaccgccacccccggcccagccaacacacacaccacaccttcttaa caacaaacacacaccagagctcacacccaacgacgacactcccctgctcc cttcctttcgcctctgaaaaactttgaaacgagagaagaagatggacacc atcaccgtcgtcgagaatgtgttcggggaggtggagcgcaaggtgcagaa gagctactgggaggagcactccaaggacctcaccgtggagtccatgatgc tcgactcccgcgccaaggacctcgacaaggaggagaggccagaggtgctg gccatcctgccgtcgtacgcggggaagacggtgctggagctcggcgccgg catcggccgcttcaccggcgagctggccaaggaggccggccacgtcatcg cgctcgacttcatcgacagcgtcatcaagaagaacgaggagatcaatggg gacatctacaagaacatcaccttcatgtgcgccgacgtcacctcgccgga gctcaagatcgaggacaactccattgacatcgtcttctccaactggctgc tcatgtacctcaacgacga
Download
page-top