Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677782
Length 866 bp
Fasta Format > whok10b22
atggctccgacgtcgaagatggcgctcggcataaagcgggcgtcgagatc gcacacctaccaccgccgcgggctttgggccatcaaggccaagcacggcg gcgccttgcccaaggccgagaagccggccgccgtcgccgagcccaagttc tatcccgctgatgatgtcaagccacgcaccgtgagcacacgcaagcccca tcccaccaagctcagatcgaccatcacaccgggcacggtgctgatcctgc tcgcggggaggtacatgggaaagcgcgtggtgttcctcaagcagctccag tccggccttctcctcatcactggacctttcaagatcaatggcgtgccaat ccgcagagtgaaccaggcttacgtcattgccacatccacaaaggtcgaca tctctaaggttaatgtgcagaagtttgatgacaagtacttcgctagggag aagaagactagggcaaagaagactgagggcgagctatttgagtcggataa ggaggcaaccaagaatttgccagacttcaagaaggatgaccagaaggtca ttgacgctgagttgatcaaggctatcgatgctgtcccagaccttaaaaat tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagat gaccttctaagttacctggtacaagtttcaagatctgtggaagtcttttt tgtctagtgtgtgttctggttctgtacttctgatttcttttgcctggttg gtgaatatttgatttccactgaagtctgcctgtcaaatattttganaana taactangaagtaccatcccctttgttggcttgttgtgacattttcttga tccatcgtcntattat
Download
page-top