Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677776
Length 657 bp
Fasta Format > whok10b12
atcatctctgcctgagctcaccaccactactagtgctagctagcttgatc gtgatggcccattctgctgttgctcaggtcgtgctcgtcgccgtggtggc cgctatgctcctcgcagccacggaggcggccgtatcgtgcggtcaggtga gctctgccttgagcccctgcatctcctatgcacgcggcaacggcgccaac ccgtctgcggcctgctgcagcggcgttaggagtctagccagctcagcccg gagcaccgctgacaagcaagcggcgtgcaagtgtatcaagagcgctgctg ctgggctcaacgctggcaaggccgcgggcatccccacaaagtgcggcgtt agcgtcccctacgccatcagctcttcngtcgactgctctaagattcgctg atcgagcacttgctgccatcgctgttgctggatctacgcttagtatgttg aggtcacacacacgcacacacacatatatatatgaataaatgctctcata ttatctcactgcgtgagagagagaggagtacgtacgtcaagcagctgtgc atggccggcccgagtttggttgttcctccactccccgagtatgctgtact ttgtaccatgtgtaattttgatatatggattgtatactcanctgatcaaa aaaaaaa
Download
page-top