Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677764
Length 446 bp
Fasta Format > whok10a19
gtcctgtncacccactcactcnttgagcacnccgatgnctctatccttct tgacaatgaggccatctatgacatctgccgccgctcccttgacnttgagn gcccaacatacaccaacctcaacaggcttgtttctcaggtcatttcatca ttgactgcttccctgaggnttgatggtgctctnaatgttgatgncaacga gttccagaccaacctggtgccctacccnaggatccacttcatgctttcct cctatgccccagngatctcagccgagaaggcctaccatgagcagctgtct gttgctgagatcaccaacagcgcctttgagccttcctccatgatggccaa gtgtgacccccgccacggcaagtacatggcctgntgcctcatgtaccgtg gtgatgttgtgcccaaggatgtcaacgctgctgtggncaccatcaa
Download
page-top