Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677761
Length 661 bp
Fasta Format > whok10a15
ggcggcggcaagaaaggccaagctgatggccgacggcgacgacggcatgg tcaccagctacagcaacatcgactcccagttttggctcgtctctggacat gcctggcatggacgactacctgcagctgcagcaggactccgtcgcctgca gggtccgcgccaagcgcggctgcgccactcacccgcggagcatcgccgag agggaaagaagaacgaggatcagcaagaggcttaggaggctgcaagacct cgtgcccaacatggacaagcaaacaaatacttctgacatgctggatattg ctgttgactacatcaaagtgctgcaggaccaaatcgagaaactgaaacag gaccaaggaaactgctcttgctcagccgatcagaagtgctgacgccgaaa cccagatatgtgaggttatgtttgtaccaatgtgattagcaagcccaagt tttgcttcgggagattaagttgtaaatgcccttcgtatctcaagtagtct ccatatgcctatcttcccctttcgtggttgtactatggattactagtttc aatggcttaaagactaggaggtgacaagtagagtgttgtaatttgagtat gtaaggcattgccaatctttcatttcaacgcaagttggatcgcttctgct taaaaaaaaaa
Download
page-top