Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677747
Length 461 bp
Fasta Format > whok10a01
caggcaacattgggaaccttaaattctctggttgtcacatatgggagtca aattggctcgtcctcttatgaaacgatattanctgaactttctactctca naagtgacgtcgatttgcatatggccgctctagcgttggaactgtgttgc acaataatggttgacagaagttccgttaaaaatgttggtttacctgtgaa acataaagttttgcctgaggcccttactttgatcaggagtgctctgttgc aaggacacgcactgcaggcgctacagaagttttttgctgcactggtccaa tctgcaaatataagctttgaaactttgttgaactcccttatttccactgc taaaccatcacagtcaggcggtctttccaagcaggcactgttctctattg cacagtgtgttgctgtgctatgcttancagctggtgatcagaantgtgcn tcaanctattg
Download
page-top