Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ568570
Length 786 bp
Fasta Format > rwhms20h06
tacgcggcacacagatattgcacagaaaacagttctgaacttcagatgct ccaaaatcaggctaacccttcatgataccagaaagctaaagcttcatgtc agaccttcacttcttggccttggccttctttggtgccgctgctgctggag ctggagctgcagccgctggtgctggtgcatgatctctggggccctgagcc aatctctcctccctcctggcatgcttcctctccctgcttgccttgctctt ggcgcgcttggcctcaaactgatcagagagggtcttctctcttgccttct cagccttggacttgtggatactctccatgaggaccctcttgttcttgaac atgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgat cttcttggcctcacggtacttgcgcagaaggcgcctcaggacgcgcatcc tccgcatccacaggatcttggtggggagcctagcctccctggtaccccta cgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccct ccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaac catcctttaccagcttccggatgttctgccgggagttggccatggagatc tcgttgacctcattggggtcgagccagaccttgcccttgccgcacttgag gacgctcgaggccaggcgcttctgcagcttcagcgacaccatcttcgccg ccgctctcctcctcccttacctgccgtctggttgtg
Download
page-top