Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ567934
Length 769 bp
Fasta Format > rwhms19a06
gtagcataactgttcaattgcgacttaatgaatgattttccagattagta ggtacatctgacttaataaatgattttccagattagtaggtacatctgac ttaataaatgattttccagattactaggtacttctgacgatcctgccggt ggaaattcacggtcacagatttgtccagaatcaaatagctcttcacgtct cttcagccatcgaagctccaacgagagaaacatccattcgacggtgcagc gataattgtactgtaagcttcatttgggtaatacacggaccacttacagc tgttcaagctacataaattatttctaacataagacatcttacattatgaa gcagctgaccacaagaaatagggtctaaaatgttcttacaggataatatg atccttccatacagagaaatacttaaatttagttcagaatatcatacaaa taaacacaattttgagtgaagaacatatgtgcaagatttggttatgctgg actgcatgtagttgtcgagtacagatttgtgatgatgttgtacaatttct ctatatcaatgcaagtaacttctgaatgaattcaagataatttttgaatg aaataggtactttgtcaaagcttatgtacggttcagcggtatgtaaatta tcaattgtacctttggtctttcgagggtagctccatgaacgatttgcgac ggtagaacgttgtgccatgtagtcggatcggacgaggggtgcggacaaag gagcacaccagcacacagg
Download
page-top