Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ299294
Length 325 bp
Fasta Format > rwhsl29k08
ctctgatgtgacggnggcagaaggatttcaagtactctaaaacatttagc tagangggactaaaccattgatcataaccgccaacaaaaatattttcctt gtttacagaacaccatctnacttcgcacttncgtttcaaacagattactt tgaggtcgtcttgtccttggtcttctgtattttcaacaccttcttcacga tcttctgctcctcaaccaagaaagcgcggatgatcctttccctcaccgca gttccagagagcactncaccatagggacggttcacagtcctgcggttcct agacaaccttgatcttttgtattca
Download
page-top