Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ567521
Length 737 bp
Fasta Format > rwhms17i23
gcgacttaatgaatgattttccagattagtaggtacatctgacttaataa atgattttccagattagtaggtacatctgacttaataaatgattttccag attactaggtacttctgacgatcctgccggtggaaattcacggtcacaga tttgtccagaatcaaatagctcttcacgtctcttcagccatcgaagctcc aacgagagaaacatccattcgacggtgcagcgataattgtactgtaagct tcatttgggtaatacacggaccacttacagctgttcaagctacataaatt atttctaacataagacatcttacattatgaagcagctgaccacaagaaat agggtctaaaatgttcttacaggataatatgatccttccatacagagaaa tacttaaatttagttcagaatatcatacaaataaacacaattttgagtga agaacatatgtgcaagatttggttatgctggactgcatgtagttgtcgag tacagatttgtgatgatgttgtacaatttctctatatcaatgcaagtaac ttctgaatgaattcaagataatttttgaatgaaataggtactttgtcaaa gcttatgtacggttcagcggtatgtaaattatcaattgtacctttggtct ttcgagggtagctccatgaacgatttgcgacggtagaacgttgtgccatg tagtcggatcggacgaggggtgcggacaaaggagcac
Download
page-top