Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ567473
Length 761 bp
Fasta Format > rwhms17f14
caccaccaccagtctatggggctccctcccgagccagaccaggaggcagc caccgcctgctacgctacaagcggcgacagcaaccttccccggcaacatc acatacgggggagcctcaaatcttgcgacaacaaccataacacggctacg acatatccagaccacattgcaatgtcattgacagtagcaaacactagcta ggagcttgcggggcgtcgcaaagccggctttactgcccctcgctcgagtc gttctttggagcctccctgatctcctcctccgcggtgtcctccgtgatgt cagaagtccagagggtcaagttatcacgaaggagttgcatgatcaaggtg ctgtccttgtaggattcttcgctcagggtgtccagctccgaaatggcctc atcgaatgcctgctttgcgagattgcaagcacgatcaggcgagttgagga tctcataatagaacaccgagaagttcagtgccagcccaagcctaatcgga tgagttggagccagctcagccaaagcaatatcctgagcagccttgtatgc caccatggtattctcagcagcatccttcctctcaggcccactcttgaatt cggcaagatatctgtagtagtcacccttcatcttaagatagaagaccttg gactcaggggcagtggaagacgggacaaggtgggtttcgagcagcttgag gatgccatcacagatcttgctaagctcagtctcgatcttgccacggtact ccttgatgagc
Download
page-top