Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ567250
Length 535 bp
Fasta Format > rwhms16j07
atcccaaggtggtttgcagtactcattgcacagatacttaggtctcaaac atattaaatccgcaaaattcgacctaaaagcacataagataagtaatcct tagcataaaagattccacaggagaactggaattgaactgcttagtcgaac aagctgaagcccatgtcatcatcgctctcttccttagcctcctccttttt ctcttctttcttctcttcagcggcagcagcaccaccagcagccggggcag cagcagcagcagctggagcaccacctccaccagatccgacggaaaggatg aggtcatcgacgctcctcttctccaggagcttggcgaagagcgcgggcca gtaggcctcaaccttgattccggcagccttcaccaccgtcgcgatcttct cagaagtgatggggatcccgtcatcgtggaggatgagggcggcaagggtg caggcgacctcgctggaagacatggcgacggattctcaccggagcagatc tgcgatcttgggaggcgatggaagtggaggcgcag
Download
page-top