Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566583
Length 705 bp
Fasta Format > rwhms14b20
atcgatagacatcaaaacaaagtgatagggacatcccaatagcaatacag ccacgactcaacagacagaaaataatagtgcagctctcttagcagcaaaa gcaaactagacccatatgataacagaactaaaagtttagagcttgtcctc gaaatcagatagaggggtcatctgttccttcagacccttgcgcttgcgga tctccgtgacaagggtcgcagactgggagccggcctccaaaggatccgaa gacatgatgtcccagtggtcgaacacacactgggggaaagcctggccaga tgtcgcagccctgagggtacttgagaacccgaacgactcgatgaccggga ggtaagccttgatgttgtacagcggggtaccaggcctctgcatctcctca aacacgtgccctctcttctgattcagaacaccatagataccgccgagtgc attctccggggcctggatctcaaccaggtacacaggctccagtagccttg gcttagcagtgagctgagaagcataaatgaccctccgggctgttgggatg acctgaccaccacctcgtgccgaatcggcacgagggagagagagagagag agagagagagagagagagagagagagagagagagagagagagagagagag agagagagagagagagagagagagagagagagagagaganagagagagag agaga
Download
page-top