Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566541
Length 496 bp
Fasta Format > rwhms13p06
aattattcnttacntatatataatataantacagatgcacggagtcacac naagatgatggangngcacggcggctggatcatcagatgatagggtaaag cgggnacttggcaatgccgcacaagcccaagggtggcgagtccctaagga aatanacgaagcctttgtcgccccactggtcattccacgagttcttgcca atccagtacttggtcccgtcaggcttggtcccgtacccgacgatggccag cgcgtggttctgcgttgtcccgcacgcccctttgttgtacacgcccgacc tggagcaaccggcgttgtacacgccgcggatgtagtgctggaagcagggg tcactgtagtcnaaggatgcggcgacgggctgctgcgccacggccgccat cagcgccgcctcgtcaccgggtggtgaaatcttcttgtagcctctgagct tcaccgcgaccggcttggccctttggcacgtgcccnccttgccggt
Download
page-top