Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566527
Length 602 bp
Fasta Format > rwhms13o11
ggtaatgccataacatttccggctcccagatagagtaaccatgctgaaag ttgaaaaataaacaaaaaaaagaagatcaacaatcttcagctggcatgac tccacttcacaaaaggattagcacaccacatctatatgtactagtatcaa gtagtattaactaaagacagacgcaatgacacagaaccatccttcaaaat gaggcaacaagttgagattaacacagatggcaatacgcggcagggtaact cttgtgatctagtgcttcttgttcttcgggatcttcgacaggaccttctc ttcaaagatggcataatacttcttcaattcgatcatggccttctcaccaa aagcatccaccttgtcatcgtacttctcatacagaactggcacagtgtac agcaccacaaagactatatatgacagtgtcaaaaagttgcagtagctccc aagaacagaaagaagccagagccctccaatcacaatgaggaatttcttca gatcacgaccatgaccagtctctctcaaggtaaagaagccccggttgatc tcatgccgcagtgatagtgcaatgtttacagtcatgtcctccgggatttt ca
Download
page-top