Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566303
Length 710 bp
Fasta Format > rwhms13c08
tgtggaataaatacgtaggaaaatgattataagcataatccatatatata ctggaagtgtacgcggtacaacgtacaataaagtctcggttctcctcaaa ggtagtgaaagtaaaaacaaccatagtagtagtacaatagttgccggcca tgcagagctagctcggcgtacgcactcctttctccctcacatggagatca gatcagagcatttattcatatgtattagagacctcagcatactcagcggt gatggatggcgctatggacggcagccatggtgggcagtggttgatcagcg aatcttagagcagtcgacgttagcgctgattgcatatgggacgctgacgc cgcacttggaggggatgccggcggccttgccagcgttgagcccaccggca gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggc tgccccggccagactcctgacaccgctgcagcaggcagcagtcgggttgg cgccattgccgcgggcataggagatgcaggggctcaaggcggaggtcacc tgaccgcaggagatggccgcgtcggtggctacgaggagcatagtggccac catggcgaccagcacgagcggaatagctgcaccgcgagccatccctatcg agtttgcagtagtaatcgtgttgaactcanctggagatggtgagaggcta natttgctaa
Download
page-top