Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566275
Length 426 bp
Fasta Format > rwhms13a23
ggcatgcattttctcaacaaaagtttggaaagtggcatagttctgtccct ccagtagctcattcgataaccggaggtaggtgaatccaaacagtttgtgc tcaggagggccattcttgttgatgcctttcggcctcgcattcctgagtat tgtgttgtaagcagtggcatcatatcgaccgagtgcgttttcgcacgcca catgtaaaccctctctccatccagcactcagcacctgttggactagttct tctggtgcgctcttcgcctcttcgctttgctcggagtccctcatctctgc acaagtgaagttcatgctagcatgatgccttgtgagcatgcgtgctatgg ttctgtanccgtctctgtcatctaagttgtantacccanctgtganctcg gctgcatggtttggaaccctgtacca
Download
page-top