Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ566025
Length 756 bp
Fasta Format > rwhms12b21
aaggagcacttcaaaggaaaattacaaacacttgaattaaaaactttcca tgacctctcctcatgtttttatccatgttttttggcagaaaggaaattaa agattgttcagcgggcttcttcctaacccacaagacaaaataaaacagag tgtcgttctcttgtaaaggtaagcttttatttcaagaccacatcgaagaa gcagacatgagggaaccttcagcggctcagccactgcactctggtgttga tttagatccgaaggcggttagatgtcaaagggtagtctcaagaatgcctc catttgcttcgccctagtcttgatcgacatgtcaaacaccttctgcccaa attcaatcaccagtcctcccatgatactctggtcaatcttttgttcaacc aagatggttttgtctttcccaaggatatcacgcaaggtctccttaagttc tttctcctccttatcaggaagtggaacaacagtcctgacaacaactttca cctcccccctatgtgccatggtcaaatcaacaaatctctcagcaatgcgc tcaacatatttcagtcttccattggatgccagtgcagacaagaatttctt tgtgatgtcagtaaacccggcttcagagaatatttcagttatagccttca ccctggtttctttaggcactgatgtgtccttcatgaattgagaaaacata gggctcttcttggatgcccctacaacatcgagaatctcggattcaacttt ttcaac
Download
page-top