Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570036
Length 752 bp
Fasta Format > rwhms6o09
ggttcggtgaaccgaaatgtttaaagaaactctgcataagcaacatccaa cagaacaaacacgatatgatatttaaggtatctcatacgcggcacacaga tattgcacagaaaacagttctgaacttcagatgctccaaaatcaggctaa cccttcatgataccagaaagctaaagcttcatgtcagaccttcacttctt ggccttggccttctttggtgccgctgctgctggagctggagctgcagccg ctggtgctggtgcatgatctctggggccctgagccaatctctcctccctc ctggcatgcttcctctccctgcttgccttgctcttggcgcgcttggcctc aaactgatcagagagggtcttctctcttgccttctcagccttggacttgt ggatactctccatgaggaccctcttgttcttgaacatgttacccttgacc ttcaggtacatgtcatggtacatgtgcttgtcgatcttcttggcctcacg gtacttgcgcagaaggcgcctcaggacgcgcatcctccgcatccacagga tcttggtggggagcctagcctccctggtacccctacgcttaccatatcca gagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct ggagtggatcttctgaggcttcctgatgatgaaaccatcctttaccagct tccggatgttctgccgggagttggccatggagatctcgttgacctcattg gg
Download
page-top