Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569859
Length 444 bp
Fasta Format > rwhms6c11
atacatcataaattacatcgatcaccatgaacactgaacaacgcctagct actgctaatctgaatatctgatcagcaggtgcgagctggattcgcctcgc cggagcctagcctccgaatccatagagggtgcgtccctggcgcttgagtg cgtagacgacgtccatggcagtgacantcttgcggcgggcgtgctcggtg tangtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacgcc gcgggtctcctcntatatganccccgagatgcgcttcacnccgccccgac gtgccanacntcgaatcnccggcttggtgatgccntggangttnncccgg ancaccttncgatggngctnggcgccncccttgccgaanncnttgnntcc cttgccgcgancccgacatcttctccattctctctnnttctcnt
Download
page-top