Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569750
Length 757 bp
Fasta Format > rwhms5l17
ggaataaactaaatatttagttttaaactcataacctccatccagaaagt aacacgaacaaaataagataactgaacgctggctaggaatgtcgacagaa gtactcaagaaatcagccatcaaaactgactacaaagttcacgacaccca ggtggcacatatatcatcttctagatatgaagcagcaaaatagcgacttc tattttctactcagcagcagcaacctcctccgctccaggaatcacctcat ctccatcagcaggcctgtcaagcttcacaccaacatcctccttgtagtca ccgtgcacctccatgagcttccccaggtcaaacttgggggccttcaggat cttcaccttgcggacgtacacgttctggagggggaagatgcttgaggtgg ccttctcaatctcctttccaatcacctcagggatgaacttgttcacaagc tccttcaagtcacagcttgcagcttggttgaccatgatctcaaccatctt gcggcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttca cctggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatg tagttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgcca cttcctcacaagagacctgagcttgtcagtggtgaagtccatgccccaga agtttgtgaggacattcatcccttgcacatcctcagcacggagtctgatc ttcctgt
Download
page-top