Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569584
Length 225 bp
Fasta Format > rwhms5c20
ttgaggatctcataatataacaccgataagttcagtgccagcncaagcct aatcggatgaattggagccagctcagccaaagcaatatcctgagcagcct tgtatgccaccatggtattctcagcagcatccttcctctcangcccactc ttgaattcggcaagatatctgtagtagtcacccttcatcttaagatagaa gaccttggactcaggggcagtggaa
Download
page-top