Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569323
Length 564 bp
Fasta Format > rwhms4e13
cattttcattctaaaaagaccatcccaaggtggtttgcagtactcattgc acagatacttaggtctcaaacatattaaatccgcaaaattcgacctaaaa gcacataagataagtaatccttagcataaaagattccacaggagaactgg aattgaactgcttagtcgaacaagctgaagcccatgtcatcatcgctctc ttccttagcctcctcctttttctcttctttcttctcttcagcggcagcag caccaccagcagccggggcagcagcagcagcagctggagcaccacctcca ccagatccgacggaaaggatgaggtcatcgacgctcctcttctccaggag cttggcgaagagcgcgggccagtaggcctcaaccttgattccggcagcct tcaccaccgtcgcgatcttctcagaagtgatggggatcccgtcatcgtgg aggatgagggcggcaagggtgcaggcgacctcgctggaagacatggcgac ggattctcaccggagcagatctgcgatcttgggaggcgatggaagtggag gcgcaggaggcagg
Download
page-top