Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569121
Length 124 bp
Fasta Format > rwhms3i03
gccgacggcaggcggttgagccttcccttgatgcccttcacggagatgat gtacaggttcttggcgcccgtgttgtcggcgcagatcaccgtcgntgncn ccggcaganccagngacatcctga
Download
page-top