Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565681
Length 715 bp
Fasta Format > rwhms10o06
ttcctcttgcagcaaatgtactgtcctgtaaatcatcaggcaaaagggga gctacaagcctcattcatacacacttggaaaaccagcgaaaaggagcatg catcgcgatgtgcggctgttctgggtggagacgagagtttctaaagagcg gaaggtttcatttattcaaaacatccagaggagcagctgcccttcgaatg tggatttacgccaggcatgagtaggccaacgccttctcctctgacagctc ctgggcggtcgcatccatcttcttcctcgagaactcatcgatcgggagcc cttgaacaattgtccattcaccaccactgcacgttactgggaaggagtag ataagaccagcaggcacaccgtatgaaccatcagagtacacacccatgga aacaaatgttccctcagcggttcccagaacccagtcacggatgtgatcac aagctgagctggcagcagagagagcactggagagcttcctcgctttgatg attgcagcaccacgctgctggacagtggcaatgaactccccatttagcca ttcatcatcttgaacaagttcacgaacaggcttctctccactgggagtct tcacagtggcatggttaacatcaggatactgactggacgagtgattaccc cagataatagcattcttaacgtcagaaacttggacaccaagtctctcana aatctgaccgagtgc
Download
page-top