Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565524
Length 465 bp
Fasta Format > rwhms10g04
tcagcttctcatancacaagagnaagagcaccgtcgnggatgggattagg cccccaccaagaaaggacagcgagcgttgttggcctgaacatggcgctca taccgcgacatgaccctgccgtcnctgccgatgttgtcgtcctgcgagtg gtagccgnccgacacatccncatccgagtaatccacttggtccgtctgtg gnttggtggantccatccangccaggaacgctgccccctcctcatcccgc tccaactccaccttcctcttggagccacacttctccgcctccttctccgc ctccgccttggcgtcnaggaagtcctcctccttctccagcagcgccacga acttgatgagcgcctcctcctcctccttggtgagggtcctcaactccacc ttggccttgacctcctttgacttggcctcgacctccggcttggcctcctt cgccttggcctcctt
Download
page-top