Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565523
Length 613 bp
Fasta Format > rwhms10g03
tgacattgcttcatcggtgcgcaacaatagcatcagggtaggcggatcaa tcccacatatatatgtccacaggatcaactagaaatatagatagataaga tagatacatggttggtactagatgggatagcaatggcgaagctcctcgtc agcttctcagaccacaagagcaagagcaccgtcgtggatgggattaggcc cccaccaagaaaggacagcgagcgttgttggcctgaacatggcgctcata ccgcgacatgaccctgccgtcgctgccgatgttgtcgtcctgcgagtggt agccgtccgacacatccccatccgagtaatccacttggtccgtctgtggc ttggtggactcgatccacgccaggaacgctgccccctcctcatcccgctc caactccaccttcctcttggagccacacttctccgcctccttctccgcct ccgccttggcgtcgaggaagtcctcctccttctccagcagcgccacgaac ttgatgagcgcctcctcctcctccttggtgagggtcctcaactccacctt ggccttgacctcctttgacttggcctcgacctccggcttggcctccttcg ccttggcctcctt
Download
page-top