Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565521
Length 556 bp
Fasta Format > rwhms10g01
aaagtaacaaggtagataggagaattattccagagaattacatagggtaa caaaagtcacttgatctattcgattttgagaactaggctcctctgtttga tcatggtaagacaatgttcctgcctcattgtgtctgccctacaagagtaa gtttcccatacatagtcctattcgatttgataactgggcgatcgtgctgc gccgagctgcctacagatcagcgtcatcctcctctgatttgctagatggc tcgccattgacagcgacaagctctgtgtcgaatatgagagttgctccgcc tggaatggtaggtggtgatccctgatccccatagccgagctttgaaggga tcttcagcttcctcttctcaccaatgcacatgcccaaaattccctgatcc catcctttgatcacttgaccagtgcccaattcaaattcaatcgggtcacc cctttcaaagctagaatcgaaaactgttccatcggtaagtgttccacggt agtgaactttaactctgtcacctttgtgagccgagatgctgcaggattct ggcttg
Download
page-top