Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565519
Length 642 bp
Fasta Format > rwhms10f23
acagatcatgtccaccatacgcagatcaaaacacctcgaacttaagcctt gagttcaaaacattacttgccacaagtaacagatctaaaagacataaagc ataatataggggtacgatgacgatgcggaggaacctaggcgcggttgcca ccgcggggtccgttgaagggctggcggtagggggcggcggcagaggtggt ttcgggggcgcgctcgacgccggggaggtcagccatgccgaggaacgcca gcatgtccatggtctccttgtcgacgcggatctcgtcgacctcgagcgcc gacttctccggcacgaagtccatgcggcgctcacgctcctcctcctgcag cttgagggagatgccgcgcacggggccgcgctggatgcggcgcatcagat gggtggtgaagccggccaccttgttgcggaggcgcttcgactggaggatg gagacctcctctagcaccttcttgttggtgtggaagtcgagggtcatccg agagtantacttctcgatgacctggcgggaggtcttcttcacggtcttgg tgcggacgcgacccatggctgcggctgctccctctccttctccngcggcn gcggcggcnacngcnctggttgntggtgcngcnncncnangg
Download
page-top