Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ565516
Length 724 bp
Fasta Format > rwhms10f19
acatggatcccacaaagagtttcagctttagagcagaatactgatctatc tttgtccttgtatccttttttcttctccaaactcgagtgtgatgcatttc tcctattcatgtatcgtgtgcttctccaatgattcattccaaggggatga tggaatctccagattcagagaacttgaagtacatttggggatattctggc acatcttcaccagtttcaatgatgagatccccttccttccgacgatttgc caaagggcgagatccaccaccctttgcatgagttgcgaattcatcaaaca cttttggactcatggactcttgtagcttcccatcagcgaattcacttact ttcagagtgtaaggcaatttagccttgttgacacggtggaccatccgaac agtgtccttgaatacatcaaaccggcgaaccatctcatcatggtcacgct tctggttcaaagtgttgcaccagcgcagatacaaggcccacagggcttcc tctgactcaacgtcctcgtctgaaggcagaattttcaccttacctgggag gggggtgaaggaagcgggcgacgacatttcgtccggtggtgcgtcggtgg agatgggtgtgttaccaccggtgccgctgtggaaggagaggcggctcctc anatctgagggggctgatcgagccgctgtcaccggcgctgcccaccgacc anccgacgcgatcttgctggcggc
Download
page-top